Review





Similar Products

86
Servicebio Inc u6 forward pcr primer
U6 Forward Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/u6 forward pcr primer/product/Servicebio Inc
Average 86 stars, based on 1 article reviews
u6 forward pcr primer - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Fasmac Co Ltd forward actgggttttacaaacctgtga
Forward Actgggttttacaaacctgtga, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward actgggttttacaaacctgtga/product/Fasmac Co Ltd
Average 86 stars, based on 1 article reviews
forward actgggttttacaaacctgtga - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre wildtype forward gca aag aga cct cat ctg tgg a
Primer Chatcre Wildtype Forward Gca Aag Aga Cct Cat Ctg Tgg A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer chatcre wildtype forward gca aag aga cct cat ctg tgg a/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag
Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre mutant forward caa aag cgc tct gaa gtt cct
Primer Chatcre Mutant Forward Caa Aag Cgc Tct Gaa Gtt Cct, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer chatcre mutant forward caa aag cgc tct gaa gtt cct/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
primer chatcre mutant forward caa aag cgc tct gaa gtt cct - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag
Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg
Tiparp Primers Forward Tgtttg Gccgtgacaggata Reverse Gcatgctttccacagcatcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg
Actb Primers Forward Actcttccagccttccttcc Reverse Tctccttctgcatcctgtcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer smo l l common forward gga ctc gca gga gga agc
Primer Smo L L Common Forward Gga Ctc Gca Gga Gga Agc, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer smo l l common forward gga ctc gca gga gga agc/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
primer smo l l common forward gga ctc gca gga gga agc - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results