|
Servicebio Inc
u6 forward pcr primer U6 Forward Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/u6 forward pcr primer/product/Servicebio Inc Average 86 stars, based on 1 article reviews
u6 forward pcr primer - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Fasmac Co Ltd
forward actgggttttacaaacctgtga Forward Actgggttttacaaacctgtga, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward actgggttttacaaacctgtga/product/Fasmac Co Ltd Average 86 stars, based on 1 article reviews
forward actgggttttacaaacctgtga - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac/product/Sangon Biotech Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a Primer Chatcre Wildtype Forward Gca Aag Aga Cct Cat Ctg Tgg A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer chatcre wildtype forward gca aag aga cct cat ctg tgg a/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag/product/Sangon Biotech Average 86 stars, based on 1 article reviews
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer chatcre mutant forward caa aag cgc tct gaa gtt cct Primer Chatcre Mutant Forward Caa Aag Cgc Tct Gaa Gtt Cct, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer chatcre mutant forward caa aag cgc tct gaa gtt cct/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
primer chatcre mutant forward caa aag cgc tct gaa gtt cct - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag/product/Sangon Biotech Average 86 stars, based on 1 article reviews
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg Tiparp Primers Forward Tgtttg Gccgtgacaggata Reverse Gcatgctttccacagcatcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg/product/Sangon Biotech Average 86 stars, based on 1 article reviews
tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg Actb Primers Forward Actcttccagccttccttcc Reverse Tctccttctgcatcctgtcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg/product/Sangon Biotech Average 86 stars, based on 1 article reviews
actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer smo l l common forward gga ctc gca gga gga agc Primer Smo L L Common Forward Gga Ctc Gca Gga Gga Agc, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer smo l l common forward gga ctc gca gga gga agc/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
primer smo l l common forward gga ctc gca gga gga agc - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |